Sequence ID | CAS01_027_N05.r (DB947392) | |
Sequence Length | 251 nucleotides | |
Gbrowse Mes | ||
Gbrowse Rco | - | |
Gbrowse Ptr | Mapped | |
Gbrowse Vvi | - | |
Gbrowse Ath | - | |
Transcript scaffold composed of the full-length cDNA(s) | Scaffold10755 | |
Related probe ID of RIKEN ver.1 microarray | R_Mes01_008388 (Scaffold10755) |
>CAS01_027_N05.r GTGAGAGAGAGAGGATGGCAGCACTTATTACCAGCACCCCGAGCAGGGTCATCTCCATGAGTATAGAAGAAGCTGGGTTA AGGGAGATGGAGATTATGAATAAATTCCAAGAGAGAAATGCTAAAATCATTCCGGAAGCAAACTCACCATGAAGAGTTTG CTTCTGGAATGATTTTAGCAGGGAAGTTGATGAAGAAGATGATGATCTCCTGGTACAGAAGGAAAGGGCATGGGATGACT GGAAAGATGAT |
vs DB | Program | Description | Score | |
---|---|---|---|---|
NCBI nr | blastx | ef|XP_002318432.1| predicted protein [Populus trichocarpa] >gi|... 95 3e-18 >ref|XP_002318432.1| predicted protein [Populus trichocarpa] gb|EEE96652.1| predicted protein [Populus trichocarpa] | 95.1 | 3e-18 |
Manihot esculenta | blastn | - | - | - |
FGENESH CDS | blastn | - | - | - |
Arabidopsis thaliana | blastx | AT5G53000.1 | Symbols: TAP46 | 2A phosphatase associated protein of 46 kD | chr5:21485654-21487869 REVERSE LENGTH=405 | 69.3 | 5e-13 |
Populus trichocarpa | blastx | POPTR_0012s02360.1|PACid:18230480 | 95.1 | 1e-20 |
Vitis vinifera | blastx | GSVIVT01038559001|PACid:17842795 | 94.7 | 8e-21 |
Ricinus communis | blastx | 29475.m000231|PACid:16802916 | 67.4 | 2e-12 |
InterProScan |
GO:0009607
Biological Process response to biotic stimulus |
GO:0009966
Biological Process regulation of signal transduction |
Sequence: CAS01_027_N05.r_1_ORF2 Length: 50 aa | |
No hits reported. |
Sequence: CAS01_027_N05.r_3_ORF1 Length: 49 aa | |||||||
InterPro IPR007304 Family |
| ||||||
noIPR unintegrated |
|
Sequence: CAS01_027_N05.r_5_ORF1 Length: 83 aa | |||||||
noIPR unintegrated |
|