Home > Microarray > Keyword search > R_Mes01_008388

Summary
Probe sequence ID R_Mes01_008388
Target sequence ID Scaffold10755
Sequence composing scaffold 
Probe sequence length 60 nucleotides
Probe sequence
>R_Mes01_008388|Scaffold10755
TTTGGAAATTCTGACATCTTCCAGCTGGGCTCATCGATTCCCCAAATTCCATTACTAACT
 
 
BLAST results
Query ID: CAS01_027_N05.f
vs DB Program Description Score E value
  NCBI nr blastx  ref|XP_002532781.1| PP2A regulatory subunit TAP46, putative [Ricinus communis] gb|EEF29600.1| PP2A regulatory subunit TAP46, putative [Ricinus communis] 115 4e-27
  Manihot esculenta blastn  cassava4.1_008946m|PACid:17981231 436 1e-122
  FGENESH CDS blastn  scaffold00224_FGENESH1 8 exon (s) 8961 - 13140 1107 bp, chain + 436 1e-122
  Arabidopsis thaliana blastx  AT5G53000.1 | Symbols: TAP46 | 2A phosphatase associated protein of 46 kD | chr5:21485654-21487869 REVERSE LENGTH=405 99.4 3e-24
  Populus trichocarpa blastx  POPTR_0012s02360.1|PACid:18230480 110 1e-26
  Vitis vinifera blastx  GSVIVT01038559001|PACid:17842795 111 9e-28
  Ricinus communis blastx  29475.m000231|PACid:16802916 115 2e-29

Query ID: CAS01_027_N05.r
vs DB Program Description Score E value
  NCBI nr blastx  ef|XP_002318432.1| predicted protein [Populus trichocarpa] >gi|... 95 3e-18 >ref|XP_002318432.1| predicted protein [Populus trichocarpa] gb|EEE96652.1| predicted protein [Populus trichocarpa] 95.1 3e-18
  Manihot esculenta blastn - - -
  FGENESH CDS blastn - - -
  Arabidopsis thaliana blastx  AT5G53000.1 | Symbols: TAP46 | 2A phosphatase associated protein of 46 kD | chr5:21485654-21487869 REVERSE LENGTH=405 69.3 5e-13
  Populus trichocarpa blastx  POPTR_0012s02360.1|PACid:18230480 95.1 1e-20
  Vitis vinifera blastx  GSVIVT01038559001|PACid:17842795 94.7 8e-21
  Ricinus communis blastx  29475.m000231|PACid:16802916 67.4 2e-12