Probe sequence ID | R_Mes01_008388 | |
Target sequence ID | Scaffold10755 | |
Sequence composing scaffold | ||
Probe sequence length | 60 nucleotides | |
Probe sequence | >R_Mes01_008388|Scaffold10755 TTTGGAAATTCTGACATCTTCCAGCTGGGCTCATCGATTCCCCAAATTCCATTACTAACT |
vs DB | Program | Description | Score | E value |
---|---|---|---|---|
NCBI nr | blastx | ref|XP_002532781.1| PP2A regulatory subunit TAP46, putative [Ricinus communis] gb|EEF29600.1| PP2A regulatory subunit TAP46, putative [Ricinus communis] | 115 | 4e-27 |
Manihot esculenta | blastn | cassava4.1_008946m|PACid:17981231 | 436 | 1e-122 |
FGENESH CDS | blastn | scaffold00224_FGENESH1 8 exon (s) 8961 - 13140 1107 bp, chain + | 436 | 1e-122 |
Arabidopsis thaliana | blastx | AT5G53000.1 | Symbols: TAP46 | 2A phosphatase associated protein of 46 kD | chr5:21485654-21487869 REVERSE LENGTH=405 | 99.4 | 3e-24 |
Populus trichocarpa | blastx | POPTR_0012s02360.1|PACid:18230480 | 110 | 1e-26 |
Vitis vinifera | blastx | GSVIVT01038559001|PACid:17842795 | 111 | 9e-28 |
Ricinus communis | blastx | 29475.m000231|PACid:16802916 | 115 | 2e-29 |
vs DB | Program | Description | Score | E value |
---|---|---|---|---|
NCBI nr | blastx | ef|XP_002318432.1| predicted protein [Populus trichocarpa] >gi|... 95 3e-18 >ref|XP_002318432.1| predicted protein [Populus trichocarpa] gb|EEE96652.1| predicted protein [Populus trichocarpa] | 95.1 | 3e-18 |
Manihot esculenta | blastn | - | - | - |
FGENESH CDS | blastn | - | - | - |
Arabidopsis thaliana | blastx | AT5G53000.1 | Symbols: TAP46 | 2A phosphatase associated protein of 46 kD | chr5:21485654-21487869 REVERSE LENGTH=405 | 69.3 | 5e-13 |
Populus trichocarpa | blastx | POPTR_0012s02360.1|PACid:18230480 | 95.1 | 1e-20 |
Vitis vinifera | blastx | GSVIVT01038559001|PACid:17842795 | 94.7 | 8e-21 |
Ricinus communis | blastx | 29475.m000231|PACid:16802916 | 67.4 | 2e-12 |