Home > Microarray > Keyword search > R_Mes01_006102

Summary
Probe sequence ID R_Mes01_006102
Target sequence ID Scaffold07758
Sequence composing scaffold 
Probe sequence length 60 nucleotides
Probe sequence
>R_Mes01_006102|Scaffold07758
AATTAGGGCCTTGGACAAGTTCTCTCAAAAAAGTCCTATGAATGGGAAAAGATCGGCTCT
 
 
BLAST results
Query ID: Contig06586
vs DB Program Description Score E value
  NCBI nr blastx  ref|XP_002523369.1| conserved hypothetical protein [Ricinus communis] gb|EEF39085.1| conserved hypothetical protein [Ricinus communis] 350 1e-94
  Manihot esculenta blastn  cassava4.1_017001m|PACid:17978517 1106 0.0
  FGENESH CDS blastn  scaffold03581_FGENESH95 3 exon (s) 754535 - 756689 573 bp, chain + 724 0.0
  Arabidopsis thaliana blastx  AT1G01360.1 | Symbols: RCAR1, PYL9 | regulatory component of ABA receptor 1 | chr1:142138-142914 FORWARD LENGTH=187 300 9e-82
  Populus trichocarpa blastx  POPTR_0014s09280.1|PACid:18224353 350 7e-97
  Vitis vinifera blastx  GSVIVT01019517001|PACid:17829125 316 9e-87
  Ricinus communis blastx  29742.m001442|PACid:16807672 350 3e-97

Query ID: CAS01_047_H01.r
vs DB Program Description Score E value
  NCBI nr blastx  ref|XP_002523369.1| conserved hypothetical protein [Ricinus communis] gb|EEF39085.1| conserved hypothetical protein [Ricinus communis] 85.1 5e-15
  Manihot esculenta blastn - - -
  FGENESH CDS blastn - - -
  Arabidopsis thaliana blastx  AT5G53160.2 | Symbols: RCAR3, PYL8 | regulatory components of ABA receptor 3 | chr5:21561026-21561953 FORWARD LENGTH=188 68.9 2e-12
  Populus trichocarpa blastx  POPTR_0014s09280.1|PACid:18224353 84.7 4e-17
  Vitis vinifera blastx  GSVIVT01019517001|PACid:17829125 79.3 1e-15
  Ricinus communis blastx  29742.m001442|PACid:16807672 85.1 2e-17