Probe sequence ID | R_Mes01_006102 | |
Target sequence ID | Scaffold07758 | |
Sequence composing scaffold | ||
Probe sequence length | 60 nucleotides | |
Probe sequence | >R_Mes01_006102|Scaffold07758 AATTAGGGCCTTGGACAAGTTCTCTCAAAAAAGTCCTATGAATGGGAAAAGATCGGCTCT |
vs DB | Program | Description | Score | E value |
---|---|---|---|---|
NCBI nr | blastx | ref|XP_002523369.1| conserved hypothetical protein [Ricinus communis] gb|EEF39085.1| conserved hypothetical protein [Ricinus communis] | 350 | 1e-94 |
Manihot esculenta | blastn | cassava4.1_017001m|PACid:17978517 | 1106 | 0.0 |
FGENESH CDS | blastn | scaffold03581_FGENESH95 3 exon (s) 754535 - 756689 573 bp, chain + | 724 | 0.0 |
Arabidopsis thaliana | blastx | AT1G01360.1 | Symbols: RCAR1, PYL9 | regulatory component of ABA receptor 1 | chr1:142138-142914 FORWARD LENGTH=187 | 300 | 9e-82 |
Populus trichocarpa | blastx | POPTR_0014s09280.1|PACid:18224353 | 350 | 7e-97 |
Vitis vinifera | blastx | GSVIVT01019517001|PACid:17829125 | 316 | 9e-87 |
Ricinus communis | blastx | 29742.m001442|PACid:16807672 | 350 | 3e-97 |
vs DB | Program | Description | Score | E value |
---|---|---|---|---|
NCBI nr | blastx | ref|XP_002523369.1| conserved hypothetical protein [Ricinus communis] gb|EEF39085.1| conserved hypothetical protein [Ricinus communis] | 85.1 | 5e-15 |
Manihot esculenta | blastn | - | - | - |
FGENESH CDS | blastn | - | - | - |
Arabidopsis thaliana | blastx | AT5G53160.2 | Symbols: RCAR3, PYL8 | regulatory components of ABA receptor 3 | chr5:21561026-21561953 FORWARD LENGTH=188 | 68.9 | 2e-12 |
Populus trichocarpa | blastx | POPTR_0014s09280.1|PACid:18224353 | 84.7 | 4e-17 |
Vitis vinifera | blastx | GSVIVT01019517001|PACid:17829125 | 79.3 | 1e-15 |
Ricinus communis | blastx | 29742.m001442|PACid:16807672 | 85.1 | 2e-17 |