Home > Keyword search > FF382006

Summary
Sequence ID FF382006
Sequence Length 798 nucleotides
Gbrowse Mes 
Gbrowse Rco  Mapped
Gbrowse Ptr  Mapped
Gbrowse Vvi  Mapped
Gbrowse Ath  Mapped
Corresponding scaffold  -
Related probe ID of RIKEN ver.1 microarray  R_Mes01_020645 (FF382006)
 
 
Sequence
>FF382006
GTTACTTAGGCTTTTACGACATCCTGATATTGTGGAAATTAAACGCATCATGTTGCCATCCTCCAAGAGGGAGTTTAAAG
ACATATTTGTTGTGTTTGAGCTCATGGAGTCTGATCTTCACCAAGTTATCAAAGCTAATGATGATTTGACCCGTGAACAC
CATCAGTTTTTTCTTTATCAGATGTTACGAGCATTGAAATACATGCATACTGCAAATGTTTACCATAGAGATCTTAAACC
CAAGAATATATTGGCTAATGCAAATTGCAAGCTTAAAGTTTGTGACTTTGGACTCGCTAGAGTAGCATTTAGCGATACAC
CAACCACTGTTTTTTGGACGGACTATGTTGCGACAAGATGGTATAGGGCTCCAGAGCTGTGTGGATCTTTTTTTTCAAAG
TATACACCAGCAATTGATATTTGGAGTATTGGCTGCATATTTGCTGAGGTATTGACAGGGAAGCCATTGTTCCCGGGTAA
AAGTGTTGTTCATCAGTTAGATTTGATCACTGATCTTCTTGGGACTCCTTCACCAGAAACTATTTCTGGAGTTCGAAATG
AGAAGGCAAGGAAGTACTTGACAGAAATGAGGAAAAAGAAGCCTGTGCCATGTACTCTCAAATTTCCAAATGCAGATCCT
TTAGCACTTAAGCTGTTGCAAAGGCTTTTAGCATTTGACCCAAAAGATCGACCAACTGCTAAAGAGGCATTGGCTGATCC
TTACTTTAAGGGCTTAGCAAAAATTGAGAGAGAACCTTCTTGTCAGCCAATCTCAAGTTGGAGTTTGAGTTTGAGAGG

 
 
BLAST results
vs DB Program Description Score E value
  NCBI nr blastx  ref|XP_002528477.1| big map kinase/bmk, putative [Ricinus communis] gb|EEF33894.1| big map kinase/bmk, putative [Ricinus communis] 509 1e-142
  Manihot esculenta blastn  cassava4.1_005598m|PACid:17973412 1463 0.0
  FGENESH CDS blastn  scaffold03542_FGENESH18 11 exon (s) 125752 - 130476 1863 bp, chain - 767 0.0
  Arabidopsis thaliana blastx  AT3G14720.1 | Symbols: ATMPK19, MPK19 | MAP kinase 19 | chr3:4946057-4948906 FORWARD LENGTH=598 489 1e-139
  Populus trichocarpa blastx  POPTR_0001s39020.1|PACid:18237185 500 1e-142
  Vitis vinifera blastx  GSVIVT01014081001|PACid:17825142 485 1e-138
  Ricinus communis blastx  29989.m000415|PACid:16815192 509 1e-145
 
 
Gene Ontology 
InterProScan
GO:0004672
Molecular Function
protein kinase activity
GO:0005524
Molecular Function
ATP binding
GO:0006468
Biological Process
protein amino acid phosphorylation
 
 
InterProScan result 
Sequence: FF382006_2_ORF1  Length: 265 aa
InterPro
IPR000719
Domain
Protein kinase, core
PD000001[1-182]T 5e-99 PD000001 Q9LUC3_ARATH_Q9LUC3;Q9LUC3_ARATH_Q9LUC3;
PS50011[1-242]T 37.234 PS50011 PROTEIN_KINASE_DOMPROTEIN_KINASE_DOM
InterPro
IPR001245
Domain
Tyrosine protein kinase
SM00219[1-240]T 5.7e-08 SM00219 no descriptionno description
InterPro
IPR002290
Domain
Serine/threonine protein kinase
SM00220[1-242]T 1e-49 SM00220 no descriptionno description
InterPro
IPR011009
Domain
Protein kinase-like
SSF56112[1-265]T 7.8e-68 SSF56112 Protein kinase-like (PK-like)Protein kinase-like (PK-like)
InterPro
IPR017442
Domain
Serine/threonine protein kinase-related
PF00069[1-242]T 9.1e-67 PF00069 PkinasePkinase
noIPR
unintegrated
unintegrated
G3DSA:1.10.510.10[24-257]T 3.7e-64 G3DSA:1.10.510.10 no descriptionno description
PTHR11295[1-173]T 8.3e-131 PTHR11295 CDC2, MAP KINASE-RELATEDCDC2, MAP KINASE-RELATED
PTHR11295:SF69[1-173]T 8.3e-131 PTHR11295:SF69 MITOGEN-ACTIVATED PROTEIN KINASE 7 (ERK5)-RELATEDMITOGEN-ACTIVATED PROTEIN KINASE 7 (ERK5)-RELATED
seg[214-223]? NA seg segseg
Sequence: FF382006_4_ORF2  Length: 75 aa
No hits reported.
Sequence: FF382006_5_ORF2  Length: 69 aa
No hits reported.
Sequence: FF382006_5_ORF3  Length: 56 aa
No hits reported.
Sequence: FF382006_6_ORF2  Length: 65 aa
No hits reported.